Advertisement

The effect of magnesium sulfate on the activity of matrix metalloproteinase-9 in fetal cord plasma and human umbilical vein endothelial cells

Published:August 18, 2010DOI:https://doi.org/10.1016/j.ajog.2010.06.012

      Objective

      Clinical evidence suggests that magnesium sulfate may reduce the risk of fetal neurologic injury in preterm delivery. Matrix metalloproteinase-9 (MMP-9) levels are elevated in preterm labor patients. There is evidence that MMP-9 may break down the blood-brain barrier in humans, causing cytokine mediated cell injury. Our objective was to determine whether the addition of magnesium sulfate attenuates activity of MMP-9, a complex zinc-dependent enzyme, in fetal cord plasma.

      Study Design

      We collected cord plasma in 6 term, unlabored patients. Using enzyme-linked immunosorbent assay, we measured the activity of MMP-9 with varying concentrations of magnesium sulfate added in vitro. Results were verified using a human umbilical cord vein endothelial cell (HUVEC) line.

      Results

      Addition of physiologic doses of magnesium sulfate (0.07 mg/mL) resulted in a 25% decrease in active MMP-9 (P = .03). In a HUVEC line, magnesium sulfate resulted in a 32% decrease in MMP-9 activity (P = .00012).

      Conclusion

      The addition of magnesium sulfate attenuated MMP-9 activity in cord plasma and in a HUVEC line.

      Key words

      Multiple studies have demonstrated that antenatal administration of magnesium sulfate (MgSO4) to patients with threatened preterm delivery (PTD) is associated with a reduction in the incidence of cerebral palsy (CP) without a concomitant increase in neonatal mortality.
      • Doyle L.W.
      • Crowther C.A.
      • Middleton P.
      • Marret S.
      • Rouse D.
      Magnesium sulphate for wormen at risk of preterm birth for neuroprotection of the fetus.
      • Constantine M.M.
      • Weiner S.J.
      Effects of antenatal exposure to magnesium sulfate on neuroprotection and mortality in preterm infants: a meta-analysis.
      The recent Maternal Fetal Medicine Network randomized controlled trial for the prevention of cerebral palsy by Rouse et al
      • Rouse D.J.
      • Hirtz D.G.
      • Thon E.
      • et al.
      A randomized, controlled trial of magnesium sulfate for the prevention of cerebral palsy.
      is the largest and most comprehensive of these studies. A proposed theory of how MgSO4 exerts its neuroprotective effect is by antagonizing N-methyl D-aspartate (NMDA) regulated receptor activity, resulting in reduced vascular instability, less hypoxic damage, and/or suppression of cytokine/excitatory amnio acid effects.
      • Hirtz D.G.
      • Nelson K.N.
      Magnesium sulfate and cerebral palsy in premature infants.
      For Editors' Commentary, see Table of Contents
      Magnesium may also contriubute to neuroprotection by inhibiting degradation of the blood-brain barrier. A biologically plausible target for the effects of magnesium is matrix metalloproteinases (MMPs), a large subfamily of zinc-dependent enzymes implicated in hydrolysis of extracellular matrix proteins. MMP-9 is thought to contribute to brain damage in adults with sepsis by breaking down the blood-brain barrier and allowing transmigration of inflammatory cytokines.
      • Keiseier B.C.
      • Storch M.K.
      • Hartung H.P.
      Toxic effector molecules in the pathogenesis of immune-mediated disorders of the central nervous system.
      MMPs are secreted into the extracellular space by various cell types, including macrophages, microglial cells, astrocytes, and activated T lymphocytes. They are secreted as inactive zymogens and activated by cleavage. Tissue inhibitors of the MMP family (TIMPs) regulate proteolytically cleaved MMP activity by binding to and inactivating the enzyme.
      There is evidence that MMPs are associated with neurologic injury in fetuses. Amniotic fluid levels of MMPs correlate with subsequent development of cerebral palsy in children at the age of 3 years.
      • Moon J.B.
      • Kim J.C.
      • Yoon B.H.
      • Romero R.
      • Kim G.
      • Oh S.Y.
      Amniotic fluid matrix metalloproteinase-8 and the development of cerebral palsy.
      Romero et al
      • Romero R.
      • Chaiworapongsa T.
      • Espinoza J.
      • et al.
      Fetal plasma MMP-9 concentrations are elevated in preterm premature rupture of membranes.
      determined that patients with preterm labor and preterm rupture of membranes had elevated fetal plasma levels of MMP-9, independent of infection or other cytokines. To our knowledge, MMP-9 activity levels in umbilical cord serum or plasma have not been studied with respect to maternal MgSO4 administration. It is biologically plausible that the fetal neuroprotective effect found in antepartum MgSO4 therapy results from a competitive inhibition of zinc dependent MMP-9 enzyme activity. Thus, attenuation of MMP-9 activity may inhibit degradation of the blood-brain barrier, thereby protecting the fetal brain from invasion of inflammatory cytokines. In this report, we tested the hypothesis that MgSO4 decreases activated MMP-9 activity in vitro.

      Materials and Methods

      This study was approved by the institutional review board at Madigan Army Medical Center. To determine whether MgSO4 was sufficient to inhibit active MMP-9 endogenously present in cord blood in the absence of physiologic inducers of MMP-9 activity (ie, preterm labor and/or infection), cord blood from unlabored patients undergoing elective cesarean sections was pretreated with MgSO4. We chose to assay fetal plasma instead of serum because white blood cells release their cytoplasmic granules of MMP-9 in serum as a consequence of the clotting process, resulting in artificially elevated levels compared with the in vivo state.
      We collected cord plasma at time of delivery in 6 term patients between 37 and 41 weeks' gestation. No patients were in labor, and all were carrying singleton fetuses and undergoing scheduled cesarean section. Patients with underlying renal, autoimmune, or vascular diseases, and patients with gestational or pregestational diabetes were excluded from study participation. Likewise, patients who reported tobacco or illicit drug use, alcohol ingestion, or vitamins other than standard prenatal vitamins were not enrolled. All patients were normotensive through their antepartum course.
      Umbilical cord samples were obtained immediately after cord clamping by venipuncture of the umbilical vein and collected in heparinized specimen tubes free of ethylenediamine tetraacetic acid (EDTA). The specimens were centrifuged at 1500×g for 15 minutes to extract plasma. Fetal plasma was stored at −20°C until analysis.
      After fetal plasma samples were collected, they were pretreated with either phosphate-buffered saline (vehicle control) or MgSO4 at levels comparable with those found in the fetal cord serum of patients receiving magnesium therapy for treatment of preterm labor (0.07 mg/mL).
      • Mittendorf R.
      • Dambrosia J.
      • Pryde P.G.
      • et al.
      Association between the use of antenatal magnesium sulfate in preterm labor.
      Supraphysiologic concentrations were also tested (0.7-7 mg/mL). Both total and active MMP-9 enzyme levels were measured using a modified enzyme-linked immunosorbant assay (ELISA) procedure (Amersham MMP-9 Biotrak Activity Assay; GE Healthcare Buckinghamshire, UK). Briefly, antibody-captured MMP-9 proteolytically cleaves the precursor form of a modified murokinase detection enzyme to its active form. MMP-9 enzyme activity was quantified by addition of a chromogenic peptide substrate. Optical density at 405 nm wavelength was measured using a microplate spectrophotometer (Synergy HT; Biotek Instruments,Winooski, VT). Total MMP-9 levels were measured in parallel experiments by adding excess of the MMP-9 substrate p-aminophenylmercuric acetate (APMA) and quantifying enzyme activity.
      Human umbilical cord vein endothelial cells (HUVECs) were purchased from American Type Culture Collection (CRL-1730; Manassas, VA), and grown according to manufacturer specifications. Cells were grown to approximately 75-80% confluence treated with the phorbol ester PMA (phorbol 12-myristate 13-acetate; Fisher Scientific, Pittsburgh, PA) overnight to induce MMP-9 production and secretion as described.
      • Genersch E.
      Sustained ERK phosphorylation is necessary not sufficient for MMP-9 regulation in endothelial cells: involvemnet of Ras dept and indept pathways.
      Media was exchanged and cells were cultured in supplier-recommended growth media for 2 days. Cells were pretreated for 1 hour in either phosphate-buffered saline vehicle or increasing doses of MgSO4 (0.07-7 mg/mL). Supernatants were assayed for active MMP-9 by ELISA. Peripheral blood mononuclear cells were isolated from cord plasma by histopaque 1077 gradient as described.
      • Katial R.K.
      • Sachanandani D.
      • Pinney C.
      • Lieberman M.M.
      Cytokine production in cell culture by peripheral blood mononuclear cells from immunocompetent hosts.
      We used relatitive quantitative polymerase chain reaction (RelqPCR) to examine changes in MMP-9 transcription. Cells were scraped from the plate and then aliquoted into microcentrifuge tubes and snap frozen in liquid nitrogen then stored at −70°C. RNA was isolated according to the manufacturer's instructions (Qiagen RNeasy Mini Kit, catalog no. 74104; Qiagen, Chatsworth, CA). A probe was designed from Roche Universal Probe Library probe 27 (Roche Diagnostics, Indianapolis, IN), which is specific for the MMP-9 gene, Uniprot/SWISSPROT: ACC:P14780. Probe specific MMP-9 primers were ordered from Invitrogen (5' to 3' Forward, TCTTCCCTGGAGACCTGAGA, 5' to 3' Reverse, GAGTGTAACCATAGCGGTACAGG) and used for PCR reactions. In accordance with Roche LightCycler 480 RNA Master Hydrolysis Probe Kit (catalog no. 04991885001; Roche Diagnostics), 50-100 ng RNA per 20 μL reaction was used. The level of our gene of interest, MMP-9, was compared with the reference housekeeping gene, phosphoglycerate kinase 1 (PGK-1). Calculations for MMP-9 target gene expression in relation to PGK-1 were based on measuring crossing points according to established mathematical algorithms.
      Statistical analyses were performed using a paired t test, with α = .05 determined a priori designated as defining biologically significant differences among treatment groups.

      Results

      Total MMP-9 levels varied among patients (178 ± 49 ng/mL). Levels of endogenously active MMP-9 in fetal cord blood were consistently a fraction of the total MMP-9 (6.8 ± 2 ng/mL), presumably because of association with TIMP inhibitors.
      • Miritag E.
      • Chollet-Martin S.
      • Oudghiri M.
      • et al.
      Effects of interleukin-10 on monocyte/endothelial cell adhesion and MMP-9/TIMP-1 secretion.
      The addition of physiologic doses of MgSO4 (0.07 mg/mL) resulted in a 25% decrease in active MMP-9 (P = .03) in cord blood specimens (n = 6) (Figure 1, A). A comparable percent decrease was observed with 0.7 mg/mL MgSO4 (P = .03), but 100 times physiologic levels did not alter MMP-9 activity (Figure 1, A). Because MMP-9 targets endothelial cell degradation, we tested whether MgSO4 treatment was sufficient to attenuate MMP-9 activity in an in vitro model. HUVECs were pretreated with the phorbol ester PMA to induce MMP-9 transcription and secretion.
      • Genersch E.
      Sustained ERK phosphorylation is necessary not sufficient for MMP-9 regulation in endothelial cells: involvemnet of Ras dept and indept pathways.
      Physiologically relevant doses of MgSO4 (0.07 mg/mL) resulted in a 32% decrease in MMP-9 activity (P = .00012) (Figure 1, B). Comparable results were seen after pretreatment with 0.7 mg/mL MgSO4 (Figure 1, B). Comparable to fetal cord plasma, however, in vitro treatment of HUVEC with 100-fold physiologic doses (7 mg/mL) were ineffective at attenuating MMP-9 activity (Figure 1, B).
      Figure thumbnail gr1
      FIGURE 1In vitro MgSO4 treatment attenuates MMP-9 activity in cord plasma and cultured HUVEC
      A, Cord plasma (n = 6 patients) from uncomplicated pregnancies was treated in vitro with increasing concentrations of MgSO4. Active MMP-9 was estimated in a modified enzymatic activity ELISA assay by interpolation to a standard curve created by measuring enzyme activity in increasing concentrations of recombinant MMP-9. Total MMP-9 was determined in parallel experiments by activation of all available MMP-9 by incubation with excess APMA reagent. Active MMP-9 was normalized to total protein and concentration of active MMP-9 was expressed as percent of vehicle-treated controls. B, Cultured HUVECs were similarly pretreated with MgSO4 and concentration of active MMP-9 was measured by modified ELISA (*P < .05 by paired t test).
      APMA, p-aminophenylmercuric acetate; ELISA, enzyme-linked immunosorbant assay procedure; HUVEC, human umbilical cord vein endothelial cell; MgSO4, magnesium sulfate; MMP-9, matrix metalloproteinase-9.
      Dolinsky. The effect of MgSO4 on MMP-9 activity. Am J Obstet Gynecol 2010.
      To determine whether MgSO4 altered MMP-9 transcript production of MMP-9 in HUVECs, we isolated RNA after treatment and examined transcript levels of MMP-9 by real-time RelqPCR. Although MMP-9 transcription was increased by phorbol ester (PMA) pretreatment (Figure 2, A, first 2 bars) in HUVECs in accordance with published literature,
      • Genersch E.
      Sustained ERK phosphorylation is necessary not sufficient for MMP-9 regulation in endothelial cells: involvemnet of Ras dept and indept pathways.
      MgSO4 had no effect on PMA-stimulated MMP-9 transcript levels at any dose tested (Figure 2, A, last 2 bars).
      Figure thumbnail gr2
      FIGURE 2MgSO4 treatment does not affect gene transcription of MMP-9
      A, HUVECs or B, peripheral blood mononuclear cells derived from cord blood were incubated with MgSO4 and subsequently treated with PMA to induce MMP-9 expression. RNA was extracted 3-6 hours later and MMP-9 expression was quantified by RT-qPCR.
      HUVEC, human umbilical cord vein endothelial cell; MgSO4, magnesium sulfate; MMP-9, matrix metalloproteinase-9; RT-qPCR, real time-quantitative polymerase chain reaction.
      Dolinsky. The effect of MgSO4 on MMP-9 activity. Am J Obstet Gynecol 2010.
      To determine whether the results of our in vitro experiments were applicable to cord blood in our patient population, we conducted comparable MMP-9 transcript quantification ex vivo in peripheral blood mononuclear cells harvested from fetal cord blood. MMP-9, packaged into cytoplasmic granules in human white blood cells, was moderately expressed in PMA-pretreated peripheral blood mononuclear cells isolated from fetal cord blood (Figure 2, B). However, levels of MMP-9 transcript were not attenuated by MgSO4 pretreatment at physiologically relevant doses (0.07 mg/mL) (Figure 2, B).

      Comment

      The use of magnesium for neuroprophylaxis prevention of cerebral palsy has been increasingly accepted in clinical practice, but the mechanism for clinical efficacy of the drug remains unknown. Our results demonstrate that the addition of MgSO4 at similar concentrations found in the cord blood of patients undergoing tocolysis attenuated MMP-9 activity in fetal cord plasma of our subjects and in the HUVEC model. This same effect was not observed with supraphysiologic doses of MgSO4. One explanation for this is that supraphysiologic MgSO4 at these levels may be cytotoxic to maternal monocytes and HUVEC. The beneficial effects of MgSO4 for neuroprotection may have a narrow therapeutic window, one that is poorly delineated clinically. Using our model, further information, such as a dose-response curve, could potentially extrapolate an approximate optimal dosing regimen for the beneficial effects of the treatment. RelqPCR did not show a significant impact on MMP-9 transcript expression in either HUVEC or peripheral blood mononuclear cells derived from fetal cord blood. Our data support a posttranslational mechanism for MgSO4-mediated inhibition of MMP-9 activity.
      Our results suggest a possible novel neuroprotective mechanism for magnesium involving inhibition of MMP-9. MMPs mediate important steps in the genesis of inflammatory demyelination, including cell migration, opening of the blood-brain barrier, release of proinflammatory cytokines, and myelin degeneration.
      • Hartung H.P.
      • Kieseier B.C.
      The role of matrix metalloproteinases in autoimmune damage to the central and peripheral nervous system.
      Studies using rodent models strengthen the evidence that MMPs are key to the pathogenesis of neural inflammation; intracerebal injection of MMP-9 resulted in breakdown of the extracellular matrix, leukocyte recruitment, and opening of the blood-brain barrier.
      • Hartung H.P.
      • Kieseier B.C.
      The role of matrix metalloproteinases in autoimmune damage to the central and peripheral nervous system.
      • Rosenberg G.A.
      • Kornfeld M.
      • Estrada E.
      • Kelley R.O.
      • Liotta L.A.
      • Stetler-Stevenson W.G.
      TIMP-2 reduces proteolytic opening of blood-brain barrier by type IV collagenase.
      • Rosenberg G.A.
      • Dencoff J.E.
      • McGuire P.G.
      • Liotta L.A.
      • Stetler-Stevenson W.G.
      Injury-induced 92-kilodalton gelatinase and urokinase expression in rat brain.
      In addition, immunohistochemistry in test animals localized MMP to infiltrating mononuclear cells and the perivascular space.
      • Anthony D.C.
      • Miller K.M.
      • Feran S.
      • et al.
      Matrix metalloproteinase expression in an experimentally induced DTH model of multiple sclerosis in the Rat CNS.
      MMP-9 can be detected in acute demyelinating lesions and localized to macrophages and astrocytes.
      • Kieseier B.C.
      • Kiefer R.
      • Clements J.M.
      • et al.
      Matrix metalloproteinase-0 and -7 are regulated in experimental autoimmune encephalomyelitis.
      Of note, inhibition of MMP activity suppressed the development of experimental autoimmune encephalomyelitis in a dose-dependent fashion.
      • Gibjels K.
      • Galardy R.E.
      • Steinman L.
      Reversal of experimental autoimmune encephalomyelitis with a hydroxamate inhibitor of matrix metalloproteinases.
      Humans with demyelinating disease have been found to have increased proteolytic activity of MMP-9, as demonstrated through direct investigation of cerebrospinal fluid, magnetic resonance imaging, and peripheral blood mononuclear cells.
      • Cuzner M.L.
      • Gveric D.
      • Strand C.
      • et al.
      The expression of tissue-type plasminogen activator, matrix metalloproteases and endogenous inhibitors in the central nervous system in multiple sclerosis: comparison of stages in lesion evolution.
      • Gibjels K.
      • Masure S.
      • Carton H.
      • Opdenakker G.
      Gelatinase in the cerebrospinal fluid of patients with multiple sclerosis and other inflammatory neurologic disorders.
      • Cuzner M.L.
      • Davison A.N.
      • Rudge P.
      Proteolytic enzyme activity of blood leukocytes and cerebrospinal fluid in multiple sclerosis.
      • Lichtinghagen R.
      • Seifert T.
      • Kracke A.
      • Marckmnn S.
      • Wurster U.
      • Heindenreich F.
      Expression of matrix metalloproteinase-9 and its inhibitors in mononuclear cells of patients with multiple sclerosis.
      The fetal brain may be similarly vulnerable to MMP-9 mediated injury in cerebral palsy patients.
      Because our MgSO4 treatments were conducted ex vivo, direct extrapolation to cerebral palsy pathogenesis is not possible. In addition, we controlled for variables that could affect MMP-9 levels. Specifically, we excluded preterm and labored patients that could complicate extrapolation of our results to some patients at risk for cerebral palsy (ie, pregnancies complicated by preterm labor or chorioamnionitis). Only unlabored, term patients were included in our patient population, a potential weakness in our study design, but one that we believed was necessary. Inclusion of preterm labor patients, with their varied exposure to steroids, tocolytics, and endogenous cytokines would introduce variability that we would be unable to control for in our data analysis. Specifically, we wanted exposure to MgSO4 to be the only variable affecting MMP-9 activity in our samples. This strategy optimized our ability to test the study hypothesis. Expansion of this research to patient populations with other exposures, for example, preterm labor, ruptured membranes, antenatal steroids, tocolytics, infection would be a fertile area for future study. Studies investigating MMP-9 activity in these populations and in rodent models of prematurity are indicated.
      There are still unanswered questions regarding the role of MgSO4 in neuroprotection, including timing, dose administration, as well as variability of response from patient to patient. To optimize MgSO4 use in neuroprophylaxis, it is crucial to elucidate its neuroprotective mechanism of action. Because our ELISA and RelqPCR data collectively support a role for MgSO4 in inhibition of proteolytically active MMP-9, the timing and dose of treatment could at least partially account for the variability in MgSO4 neuroprophylaxis among patients. It is plausible that MgSO4 only affords adequate neuroprotection if delivered before irreversible degradation of the blood-brain barrier; if administered too late, MMP-9 inhibition may be ineffective.
      In conclusion, our study demonstrated that magnesium sulfate in a clinically relevant concentration is sufficient to inhibit activated MMP-9 in fetal plasma in vitro and the HUVEC line. Our results support a possible novel, previously undescribed pharmacologic mechanism underlying MgSO4-mediated neuroprotection in cerebral palsy.

      References

        • Doyle L.W.
        • Crowther C.A.
        • Middleton P.
        • Marret S.
        • Rouse D.
        Magnesium sulphate for wormen at risk of preterm birth for neuroprotection of the fetus.
        Cochrane Database Syst Rev. 2009; 1: CD004661
        • Constantine M.M.
        • Weiner S.J.
        Effects of antenatal exposure to magnesium sulfate on neuroprotection and mortality in preterm infants: a meta-analysis.
        Obstet Gynecol. 2009; 114: 354-363
        • Rouse D.J.
        • Hirtz D.G.
        • Thon E.
        • et al.
        A randomized, controlled trial of magnesium sulfate for the prevention of cerebral palsy.
        N Eng J Med. 2008; 359: 895-905
        • Hirtz D.G.
        • Nelson K.N.
        Magnesium sulfate and cerebral palsy in premature infants.
        Curr Opin Pediatr. 1998; 10: 131-137
        • Keiseier B.C.
        • Storch M.K.
        • Hartung H.P.
        Toxic effector molecules in the pathogenesis of immune-mediated disorders of the central nervous system.
        J Neural Transm. 2000; 59: 68-80
        • Moon J.B.
        • Kim J.C.
        • Yoon B.H.
        • Romero R.
        • Kim G.
        • Oh S.Y.
        Amniotic fluid matrix metalloproteinase-8 and the development of cerebral palsy.
        J Perinat Med. 2002; 30: 301-306
        • Romero R.
        • Chaiworapongsa T.
        • Espinoza J.
        • et al.
        Fetal plasma MMP-9 concentrations are elevated in preterm premature rupture of membranes.
        Am J Obstet Gynecol. 2002; 187: 1125-1130
        • Mittendorf R.
        • Dambrosia J.
        • Pryde P.G.
        • et al.
        Association between the use of antenatal magnesium sulfate in preterm labor.
        Am J Obstet Gynecol. 2002; 186: 1111-1118
        • Genersch E.
        Sustained ERK phosphorylation is necessary not sufficient for MMP-9 regulation in endothelial cells: involvemnet of Ras dept and indept pathways.
        J Cell Sci. 2000; 113: 4319-4330
        • Katial R.K.
        • Sachanandani D.
        • Pinney C.
        • Lieberman M.M.
        Cytokine production in cell culture by peripheral blood mononuclear cells from immunocompetent hosts.
        Clin Diagn Lab Immunol. 1998; 5: 78-81
        • Miritag E.
        • Chollet-Martin S.
        • Oudghiri M.
        • et al.
        Effects of interleukin-10 on monocyte/endothelial cell adhesion and MMP-9/TIMP-1 secretion.
        Cardiovasc Res. 2001; 49: 882-890
        • Hartung H.P.
        • Kieseier B.C.
        The role of matrix metalloproteinases in autoimmune damage to the central and peripheral nervous system.
        J Neuroimm. 2000; 107: 140-147
        • Rosenberg G.A.
        • Kornfeld M.
        • Estrada E.
        • Kelley R.O.
        • Liotta L.A.
        • Stetler-Stevenson W.G.
        TIMP-2 reduces proteolytic opening of blood-brain barrier by type IV collagenase.
        Brain Res. 1992; 576: 203-207
        • Rosenberg G.A.
        • Dencoff J.E.
        • McGuire P.G.
        • Liotta L.A.
        • Stetler-Stevenson W.G.
        Injury-induced 92-kilodalton gelatinase and urokinase expression in rat brain.
        Lab Invest. 1994; 71: 417-422
        • Anthony D.C.
        • Miller K.M.
        • Feran S.
        • et al.
        Matrix metalloproteinase expression in an experimentally induced DTH model of multiple sclerosis in the Rat CNS.
        J Neuroimm. 1998; 87: 62-72
        • Kieseier B.C.
        • Kiefer R.
        • Clements J.M.
        • et al.
        Matrix metalloproteinase-0 and -7 are regulated in experimental autoimmune encephalomyelitis.
        Brain. 1998; 121: 159-166
        • Gibjels K.
        • Galardy R.E.
        • Steinman L.
        Reversal of experimental autoimmune encephalomyelitis with a hydroxamate inhibitor of matrix metalloproteinases.
        J Clin Invest. 1994; 94: 2177-2182
        • Cuzner M.L.
        • Gveric D.
        • Strand C.
        • et al.
        The expression of tissue-type plasminogen activator, matrix metalloproteases and endogenous inhibitors in the central nervous system in multiple sclerosis: comparison of stages in lesion evolution.
        J Neuropath Exp Neurol. 1996; 55: 194-204
        • Gibjels K.
        • Masure S.
        • Carton H.
        • Opdenakker G.
        Gelatinase in the cerebrospinal fluid of patients with multiple sclerosis and other inflammatory neurologic disorders.
        J Neuroimmunol. 1992; 41: 29-34
        • Cuzner M.L.
        • Davison A.N.
        • Rudge P.
        Proteolytic enzyme activity of blood leukocytes and cerebrospinal fluid in multiple sclerosis.
        Ann Neurol. 1978; 4: 337-344
        • Lichtinghagen R.
        • Seifert T.
        • Kracke A.
        • Marckmnn S.
        • Wurster U.
        • Heindenreich F.
        Expression of matrix metalloproteinase-9 and its inhibitors in mononuclear cells of patients with multiple sclerosis.
        J Neuroimmunol. 1999; 99: 19-26